Tested for in situ hybridization.
| Accession no. | pB-919 |
| Full name (Alm et al.) | - |
| Categories | |
| Specificity | Sphingomonas, Erythrobacter |
| Taxonomy | Sphingomonadales; Alphaproteobacteria; Pseudomonadota; Pseudomonadati; Bacteria; cellular organisms |
| Sequence | 5'-TAG CCG GAG CTT ATT CTC-3' |
| Length [nt] | 18 |
| G+C content [%] | 50 |
| Target rRNA | 16S |
| Position | 492-509 |
| Formamide | 20 |
| Check specificity/coverage |
SILVA TestProbe |
| References |
Microbial community and physicochemical analysis of an industrial waste gas biofilter and design of 16S rRNA-targeting oligonucleotide probes. Friedrich U, Van Langenhove H, Altendorf K, Lipski A. Environmental microbiology. 2003. Pubmed: 12588298 |
| Remarks | molar ratio of competitor oligonucleotide versus probe is 1 helper oligonucleotides: H433, ATCCCKGGTAAAAGAGC, H450, CMGRTACTGTCATTATC, H510, CGGCTGCTGGCACGGAGT, H528, CTAGCTCCCTCCGTATTACCG |