Probe details

SPH492

Tested for in situ hybridization.

Accession no. pB-919
Full name (Alm et al.) -
Categories
Specificity Sphingomonas, Erythrobacter
Taxonomy Sphingomonadales; Alphaproteobacteria; Pseudomonadota; Pseudomonadati; Bacteria; cellular organisms
Sequence 5'-TAG CCG GAG CTT ATT CTC-3'
Length [nt] 18
G+C content [%] 50
Target rRNA 16S
Position 492-509
Formamide 20
Check specificity/coverage SILVA TestProbe
References Microbial community and physicochemical analysis of an industrial waste gas biofilter and design of 16S rRNA-targeting oligonucleotide probes. Friedrich U, Van Langenhove H, Altendorf K, Lipski A. Environmental microbiology. 2003. Pubmed: 12588298
Remarks molar ratio of competitor oligonucleotide versus probe is 1 helper oligonucleotides: H433, ATCCCKGGTAAAAGAGC, H450, CMGRTACTGTCATTATC, H510, CGGCTGCTGGCACGGAGT, H528, CTAGCTCCCTCCGTATTACCG