Tested for in situ hybridization.
| Accession no. | pB-1210 |
| Full name (Alm et al.) | - |
| Categories |
extremophilic microbes |
| Specificity | acid mine drainage clones related to Gallionella ferruginea |
| Taxonomy | Gallionella ferruginea; Gallionella; Gallionellaceae; Nitrosomonadales; Betaproteobacteria; Pseudomonadota; Pseudomonadati; Bacteria; cellular organisms |
| Sequence | 5'-CCA CTA ACC TGG GAG CAA-3' |
| Length [nt] | 18 |
| G+C content [%] | 56 |
| Target rRNA | 16S |
| Position | 84-101 |
| Formamide | 40 |
| Check specificity/coverage |
SILVA TestProbe |
| References |
Macroscopic streamer growths in acidic, metal-rich mine waters in north wales consist of novel and remarkably simple bacterial communities. Hallberg KB, Coupland K, Kimura S, Johnson DB. Applied and environmental microbiology. 2006. Pubmed: 16517651 |
| Remarks | Requires helper oligonucleotides, unlabelled and added in equal concentrations to that of the probe. They are GALTS h1 = GATATATTACTCACCCGTTCG and GALTS h2 = GCCCCCAGGCCCGTTCGA. |