Tested for in situ hybridization.
| Accession no. | pB-1203 |
| Full name (Alm et al.) | S-S-Bact-1020-a-A-22 |
| Categories | |
| Specificity | Defluvicoccus vanus-related organisms, cluster 2 |
| Taxonomy | Defluviicoccus vanus; Defluviicoccus; Rhodospirillaceae; Rhodospirillales; Alphaproteobacteria; Pseudomonadota; Pseudomonadati; Bacteria; cellular organisms |
| Sequence | 5'-GAT ACG ACG CCC ATG TCA AGG G-3' |
| Length [nt] | 22 |
| G+C content [%] | 59 |
| Target rRNA | 16S |
| Position | 988-1009 |
| Formamide | 35 |
| Check specificity/coverage |
SILVA TestProbe |
| References |
Putative glycogen-accumulating organisms belonging to the Alphaproteobacteria identified through rRNA-based stable isotope probing. Meyer RL, Saunders AM, Blackall LL. Microbiology (Reading, England). 2006. Pubmed: 16436430 |
| Remarks | helper probes: pos966-987 CTGGTAAGGTTCTGCGCGTTG, pos1038-1064 AGCGCCATGCAGCACCTGTGTGGCGT |